Actions

Work Header

Rating:
Archive Warnings:
Fandoms:
Characters:
Additional Tags:
Language:
English
Series:
Part 22 of The Silverscale Arena Season 4
Stats:
Published:
2025-11-05
Updated:
2025-11-13
Words:
13,827
Chapters:
2/?
Comments:
5
Kudos:
8
Bookmarks:
1
Hits:
263

The Silverscale Arena Ep. 44: November 2025

Summary:

(DISCLAIMER): The following fic features a famous well-made game from 'Roblox as a major setting. Thankfully, 'Pressure' was not found to be a part of the many controversies that game has been going through recently as of this writing, so all is well.

Welcome, one and all, to the 44th episode in a series of adventures related to the craziest and most deadly arena created! 48 characters in teams of 4 compete to survive! In this one, two different settings have been combined! The Hadal Blacksite (Pressure) and Spooky's Jumpscare Mansion! A paradox has combined them both and that can only mean one thing...our combatants will have to deal with the horrors that BOTH places had within them! Who will make it through this gauntlet of terrors in an Arena that totally wasn't late for Halloween?

As usual, comments are very appreciated. The Arena server can be reached through Discord friend request: giganoto_5008

Chapter 1: Team Introductions / Specimen 7

Notes:

(See the end of the chapter for notes.)

Chapter Text

The Silverscale Lounge Arena

Ep. 44: November 2025

Hosted by Baskerra “Lounge Bitch” Hellmane

All in favor of our Lounge’s Founders

(DISCLAIMER: All characters in sexual situations are 18 and over. Just to let you know)

 

Part 1: Spooky’s Pressurized Paradox

 

(Usually, these days, the contestants of an Arena overseen by two demonic entities, each one twisted in their own way, would only concern them getting thrown into just one new dangerous world. But there have been times in which they were thrust into a world that got visitors from another, often resulting in havoc. This was one of those times…only it was an outright FUSION of scenarios.

To understand what’s going on, there are two places to learn about. Two places filled to the brim with mystery, evil, tragedy, science gone wrong, and an inability to just STOP, regardless of how many horrors festered and took form.

The first of which was a creepy but seemingly harmless mansion on the top of a hill on a planet similar to Earth in a universe far away. Within this mansion was a single cartoonish ghost by the name of Spooky, who would challenge all visitors to come brave the 1000 rooms the place had.

That’s right. 1000. Turns out, the mansion was more than it seemed. It was a spot where seemingly endless horrors (or ‘Subjects’ as they were referred to) dwelled, each one worse than the last as the unfortunate visitors delved deeper underground in the further rooms.

Even worse was Spooky’s end-goal. Being the disembodied rage of a child’s tragically cut-short life, she desired to create a ghostly army made of those who perished in the mansion, the winners of her game becoming powerful spirits under her iron grip.

Thankfully, such a plot was ended when the mansion was destroyed after one thing led to another (mostly involving a dollhouse or something) and she reunited with her parents in the afterlife, her rage finally quelled as she got to rest in peace at last.

Thanks to the actions of Aresdemonia…such peace was fleeting.

The next place was located in the deepest darkest portion of the sea. A place where light could barely reach. Where untold terrors lived and thrived. Where a supremely corrupt corporation known as Urbanshade sought to use their seemingly limitless wealth for conducting unethical experiments and storing away strange entities of varying levels of hostility.

They even managed to enslave a Guardian Angel, the poor being’s blood being harvested in order to keep the employees from being damned to Hell for their actions. Not that it was enough to save their horrifically corrupt boss from being bound for that realm.

This was the Hadal Blacksite, an abandoned laboratory containing materials that the company wanted back at any cost, even willing to pardon the most heinous of criminals (or, at least, those wrongly framed and being pressured to do so) to investigate and get what they wanted. All the while having to avoid what terrors still lurked in that forbidden facility.

Unlike the previous spot, there was no sign that Urbanshade would be stopped…but it would seem the company’s finally hit a snag that no amount of money could fix. Mainly, the merging of that accursed Mansion of Jumpscares and the Hadal Blacksite.

Indeed, this Paradox has caused the entire Hadal Blacksite to start crumbling, hopefully putting an end to the lingering horror both places wrought, but it seems that the 48 contestants sent here are about to be caught in the middle of it all.

12 boxes, each one containing four characters, are currently stationed in the Jetsuit Evaluation Course. Normally, the convicts sent here would find themselves chased by a firewall created by the insane art program known as the P.AI.nter, the jumpsuit being the only thing getting them through the course. This time around, something else has entered this place. Something that has turned it even MORE deadly…

And it’s just one example of the mingling of terrifying forces here. Which of these contestants will make it through this gauntlet of horrors? Every room of doom? And, even if they reach the exit, there’s a good chance Urbanshade will be VERY keen on making sure none leave after what they’ve seen…

 48 Characters, 12 ‘Teams’. 1 mad dash to the exit…)

 

Team #1: Predaking2000

 

It would not the first time the muscular megalodon anthro known as Velora had been sent to one of these Arenas, her nude form standing tall in the spacious Arena box, but it would certainly be a first in that she had to deal with a VERY rowdy teammate, if one could even call it that.

Slithering to a height that rivaled her own greatly, this massive freakish almost demonic hybrid of crocodile and cobra (complete with spikes lining the edges of the hood) let out a hissing roar, surging at the shark anthro with hungry intent. “Oh, sweet! They brought free lunch this time!”

The muscular one wrapped her large arms around the other’s head, only for those spikes to dig into her scales. She tanked it all, but the space was tight and the monstrous Cobragator kept squirming around, trying to latch its massive jaws around her tail or any other part of her body.

The other two were hopelessly oblivious to their surroundings, with the cat mobian of the duo being slightly less so. Big was no stranger to finding himself in random places, usually in search of Froggy, but he didn’t even have any memory of walking all the way here. Merely being teleported.

“Hello? Chris? What was the challenge again?” The ‘dumb princess’ of Total Drama herself, Lindsay, was looking around for any cameras, ignoring the clash of the titans happening in the very same box, even as Velora chomped down on the Cobragator’s tail and the behemoth managed to slam her into the wall with its head. “Have you also seen my lip gloss?”

She then realized she was in the presence of a parituclarly large cat-like being, causing her eyes to sparkle. “Oh…my…GOSH! So big and FLUFFY!” She instantly latched onto the big lug’s body, hugging him tightly and rubbing her face into his fur. “Mmmmn…never wanna let go!”

“Oh. Thank you. My girlfriend loves to do that whenever I get home. I hope she’s doing okay back there.” Big wondered. “Would you like to be my friend?”

“Totally!” She looked up at him, continuing to snuggle before she suddenly found herself face-to-face with the Cobragator, the enraged reptile roaring in her face. “Um…is that you, Tyler?”

Despite being fueled by primordial hunger, even the beast was momentarily confused before it was suddenly tugged by Velora’s arms, his head used as a makeshift mace against the door. “You two better buck up! We’re in for the long haul!” She warned, her toe-claws digging into the ground while the mutation tried to bite back.

Huddling into the bigger one’s arms, the two doofuses were soon realizing that this challenged look to be a dangerous one…especially due to the screaming they were hearing…

 

Team #2: TheStrange1

 

“The fuck?! How did I get here?!” The disgraced Hokuto Shinken warrior, Jagi, had been terrorizing the wasteland he called home before he was transported, sparring his victims of any further anguish at his sadistic hands. “Somebody better start talking!”

Despite being blinded by rage and his near-constant state of pain, he knew somebody was behind him, allowing him to whip out his shotgun and find it faced with yet another weapon similar to it, the barrels connecting as the two guys stared each-other down.

The disgraced former leader of the White Fang, Adam Taurus, was glaring hatefully at the human, both ready to fire at the slightest movement. “I don’t know why I’m here either, but if there’s one thing I do know…it’s that you human scum deserve worse than death.”

“Me?! Scum?! I’ll have you know that I’m top dog where I am!” Jagi declared, his tongue moving around his cheeks as the dishonorable fighter prepared some needles to spit at his new enemy. “You wanna talk about things worse than death? Try spending more than a minute with me!”

“You talk way too much.” Adam grunted, the two weapons blasting each-other, but it would be Jagi’s weapon that flew away, the martial artist letting out a yelp before he followed with a devastating series of strikes. Strikes that Adam was barely able to block.

Watching this whole mess with a bored expression was one of the two returners here, Juri Han. The sadistic taekwondo prodigy yawned, stretching as he got up from sitting. “Whoever wins here, you’d BETTER show me a good time! Make this random trip worth it for the both of us!”

“Oh, I can make it worth your while…”

The other returner, the Tarkatan-mutant known as Mileena, stepped forward with a sultry stare, her sais gripped in her hands. “You seem like SO much fun! I can see it in your eyes! Especially that glowing one! I could stare into it for hours!”

“Well, aren’t you a flirt?” Juri got into her usual fighting pose, grinning. “You think just because you’re the one with the sharp pointy things means I’ll be intimidated?”

Giggling, Mileena licked the sharp teeth behind her mask. “I hope not! I love a challenge! I want you to be as rough as possible!”

“Just the way I like it~” Juri licked her lips, causing the other fighter to chuckle along with her.

“We’re so in-sync! Let’s be friends…or let me gnaw on your bones! Whichever comes first!” Mileena clapped her hands, only for a shotgun shell to smack her on the head. “OW! YOU TWO KEEP IT DOWN!”

“Ignore them. Those idiots aren’t worth the time.” Juri waved her hand, especially as Jagi gripped around Adam’s ears, the two mindlessly running around before they smacked into the entrance, opening it up for the games to truly begin…

 

Team #3: Random-Person

 

This wouldn’t be the first time this Arena had to contend with the terrifyingly powerful blood-powered robot known as V1. If he didn’t win this one, maybe this wouldn’t be the last.

Standing creepily in one place, it was almost like the machine could smell the stench of death everywhere. Most would be repulsed by that, but he found it to be…enticing. It meant more fuel. More destruction. More ways to fulfill his prime directive.

Namely, destroy everything in sight. Ensure he would function forever.

“HERE I GO KILLIN’ AGAIN.” He stated in his usual distorted computerized voice.

His radar began to go crazy, detecting the presence of a truly powerful foe. One that didn’t have the blood he was used to, but blood was blood. Energy was energy. The means to destroy were the means to destroy.

Standing with a gaunt posture, a mixture of nobility and nothingness, was the being that was always meant to undo the terrible Radiance (remember that from two episodes ago?). A being that had no thoughts, but a mission that they would see to the end, no mouth there to cry suffering. A pure vessel…THE Pure Vessel.

This knight-like insectoid figure was now considerably larger than before, standing taller than the robotic being. At first, the Pure Vessel was more concerned with finding a way out, but V1 instantly got out a shotgun for each hand and began to open fire, bullets flying through the air.

The Pure Vessel was prepared for that, teleporting out of the way before summoning several spears, sending them flying at his robotic foe. More bullets would fly after the machine dodged and flew into the air, diving forth and clashing his arms against the blade of the emotionless but heroic figure.

Their audience consisted of two people who had met in their own crossover adventure. An ‘Indie Cross’, if you will. “So…feeling any better, Peasant-with-a-terminal-illness?” The strange goo-like being, the Beheaded, asked as he approached his pal. “Also, where are we?”

Wiping away some blood he had coughed onto his chin, the Drifter was quite glad to see that his friend was doing alright and no longer a golden statue. Alas, he had no explanation either, despite remembering having been sent here a while back.

“Maybe one of those portals showed up? Could have sent me back home, but nope! We had to get sent to someplace even more depressing! A box!” The Beheaded complained, several coins flying past him. He caught one, looking it with glee. “Hey! Money!”

BANG!

Bouncing off those coins, one of V1’s bullets struck his body, causing his still living amorphous head to plop down. “Do me a favor, pal. Scrap that rust-bucket!”

It did seem that the Drifter would come to blows with V1, as well…until the doors started to open, getting the attention of all four…

 

Team #4: 1nked

 

V1 wasn’t the only one from his universe to be sent here. Neither was the Pure Vessel the only one from his own universe. In terms of the former, the former Archangel known as Gabriel had found himself standing in this box, confused like the rest of his team.

“What? This isn’t Heaven…nor is it Hell…” He coughed after stating this, some of his blood escaping through the holes in his helmet. “I’m running out of time. I won’t have my final moments be stuck in-“

His defiant statement was interrupted when he heard the crying of a child, causing him to turn to the strange pink creature standing next to him. Poor Isaac had found himself in the Arena, leaving him as terrified as he usually was during his ordeal back in his universe.

The sight of an actual angel was only slightly more comforting than what he had to deal with, but he still cowered in the presence of the taller muscular figure. “A human? A living mortal soul?” Gabriel tilted his head, having not seen one of those in his world ever since the rampage of the machines.

Though more accustomed to battling and fighting for the corrupt Council (until his eyes were opened to his sins and theirs, of course), he remembered some of his gentler moments, greeting lost souls and sometimes even avenging them, despite what the Council desired. He knelt down, trying to seem less threatening. “Be not afraid, my child. Your guardian angel is here.”

Slightly more comforted, Isaac wandered closer, but he wasn’t the only one doing that. Known simply as The Knight, this insectoid vessel of nothingness, armed with nothing but his needle, stood passively, not moving an inch as he assessed what to do next.

“What cruel being would send mere children to a cage like this?” Gabriel wondered.

“A real jerk, that’s who! By the way, I like your wings! They’re so shiny!” An incredibly friendly soul and self-proclaimed ‘hint-master’, Terry Hintz, butted in. “But I’d still recommend learning from a pro if you wanna survive here!”

“There is no need. I’m fully capable on my own.” Gabriel assured. “Stick with me and I will see it that we all make it to the end.” He paused when he sensed something on the other side of the wall, causing him to start clenching around his blades. “HE’S HERE.”

“Uh, who? Demons? Satan?” Terry wondered, while Isaac cowered behind the Knight.

“Worse. The machine.” Gabriel both felt excitement at the prospect of fighting that mechanical terror to the finish, but the idea of these mortal souls getting caught in the crossfire didn’t sit well with him.

Still, as the door opened, he readied himself to face this challenge, and all other ones, with open arms…and all his might…

 

Team #5: Chianticat

 

The main gimmick of this team was ‘overpowered’. From whatever franchise they were from and perhaps in some different medium (original source material, video games, etc), they were considered terrors to fight and power fantasies to fight as (if, again, as three out of four were that case in video games).

Enough about that. A returner had come to the Arena. The ultimate android known as Perfect Cell. The insectoid being’s eyes opened as he stood with his arms crossed, realizing where he was. “I refuse to let this INSIPID scenario get the best of me. Maybe I should just annihilate those in here? Spare me the trouble.”

“ALERT: UNIDENTIFIED ARTIFICIAL INTELLIGENCE FOUND.” A hulking purple robot’s booming voice echoed through the box, his red eyes glowing as he looked down to the tall android.

Built by the paranoid and short-sighed Bolivar Trask, this ‘Sentinel’ may have been smaller than his building-sized other models, but that just meant he was faster, less bulky, and far more capable of utterly destroying those it considered ‘mutant’. Whatever filled those parameters was basically doomed.

Cell wasn’t impressed. At all. “And I thought my siblings were outdated models. I doubt you can be recycled into anything useful, given how utterly ridiculous you look.”

“INSULTS: INEFFECTIVE. INTENTIONS: HOSTILE?”

Beneath the two, a mass of purple ooze was slithering around, getting its bearings before starting to take the form of a pudgy villainous figure with a tentacle-like beard/hair. “Oooooooh, YES! THE OOZE IS BACK AGAIN!” Ivan Ooze exclaimed, spreading his arms around while lightning crackled around his fingers.

He looked around, finding himself between the intrigued android and the confused robot. “What is this? A sewing circle? Wait…A PRISON?! AGAIN?!” He fired a blast of purple lightning at the doors. “I don’t care if I’ve got cellmates! I’m not spending time I could be conquering the galaxy here!”

“MUTANT DETECTED? MORE DATA NEEDED.” The Sentinel wondered.

“I’ve got your data RIGHT HERE!” Out of anger, Ivan fired a blast of lightning at the machine, causing it to step back and try to restabilize itself.

“DANGER! DANGER! HOSTILES DETECTED! CONCLUSION: MUST DESTROY.” The machine declared, clenching its fists as it prepared to fight.

Cracking his neck in preparation for burning off his stress in battle, Ivan then noticed a much smaller caped figure with a sinister mask observing this. “You look plenty evil! Care to help a fellow villain out? Maybe become my dark servant? Benefits included?”

Meta-Knight, the mysterious protector of Dreamland, shook his head. “Apologies, but I serve nobody.” He spoke in his usual deep Zorro-like voice. “Especially not another self-proclaimed lord of all things dark.”

“You fools.” Cell chuckled. “This is amusing to watch, but I’ve got a game to win.” He charged up a ki-blast in his hand, aiming it at all three and gaining their attention. “Now, which one of you will I destroy first?”

His arm was suddenly sliced off in an instant, Meta-Knight having used his sword to do the job. Green fluid sprayed around, with the android looking appropriately shocked before he regenerated that arm instantly. “Your sadism will be the end of you. Attack with conviction, not cruelty.” The knight instructed.

“Well, aren’t YOU the wise little shit.” Cell glared, generating a battle aura.

“Don’t count me out! May the baddest of the bad win!” Ivan declared, even as the doors opened.

“ON MARK…GET SET…MOVE OUT!” The Sentinel shouted, choosing to instead rush forward to escape and return to its mission of mutant destruction rather than risk its own deactivation with the fight seemingly about to start.

 

Team #6: Kirby

 

Luigi Mario was always a little jumpy, but could you blame him now? Being suddenly teleported from looking around yet another ghostly mansion, Poltergust-5000 still gripped in his hands, to a strange new area was bound to make one more than a little startled.

“Keep your nerves, Luigi! It’s probably just King Boo trying to get under your skin!” He told himself, his New York accent echoing through the wide walls of the box and only serving to unnerve him further.

He let out a loud scream when he found himself staring at the wrong side of an arrow, the pointy tip pricking his nose slightly. “Don’t hurt me! I just got here and I did nothing wrong and I don’t know what’s happening and-“

The very withdrawn-sounding voice belonged to Bernadetta Von Varley, the painfully shy royal of the Black Eagles. Her limbs were shaking before she realized she was talking to somebody that seemed awfully reminiscent of somebody Byleth once spoke of during a strange tournament they described.

Luigi also calmed, holding his hands up. “Easy there! I’m not here to hurt you! Put the sharp thing down and we can talk this over.”

Lowering her bow, Bernadetta finally got a good glimpse of the man in green clothing. “All I remember is a flash of light and-“

“GAAAAAAAH! DEMON!”

“GAAAAAAAH! ¡¿POR QUÉ ESTAMOS GRITANDO?!”

That comically loud shriek belonged to Zenitsu Agatsuma, the blonde Demon Slayer corp member gripping his golden katana as he backed away from the large horned figure cowering from him.

In spite of his intimidating appearance (large horns, sharp teeth, big claws, shaggy purple fur), the imaginary friend known as Eduardo would never hurt a fly. In fact, he was the one the most frightened in this scenario, having been ripped from his friends and placed in somewhere where there was screaming and sharp objects.

He covered his head, shaking while the other three stared at him. “Stand back, everyone! I’ll slice him while he’s down!” Zenitsu declared.

“Wait!” Bernadetta shouted, sensing a kindred spirit in the strange demonic creature. A few more seconds of looking at him caused her to see more of herself in the poor lug, especially as he began to sadly mutter to himself in an effort to keep himself calm.

“Um…there, there?” Luigi wandered close to the imaginary friend, patting his arm.

Ceasing his cowering, Eduardo twiddled his hoof-like claws, getting a better look at his company. Even the one with the katana didn’t seem that scary, given how much he was shuddering too. “It’s…nice to meet you? How do we get out?”

“Wish I could tell you, but my brother always said where there’s a will, there’s a way.” Luigi assured before shaking his hand.

Zenitsu was already confused as to what was going on, but this just made things even moreso. This creature…he didn’t seem hostile. In fact, he looked almost benign compared to the demonic monstrosities he was familiar with. “So…we’re in the same boat.” He supposed before noticing the nerdy archer next to him.

OH NO! SHE’S CUUUUUTE!’ He thought, having to suppress the blood almost gushing from his nose. ‘Keep it together! Don’t forget you’re trapped with no way to-

Taking a deep breath, Eduardo looked at the door keeping he and the others from freedom. “Stand back, amigos. I’ve got an idea!” The fact that there was a seemingly easy way to escape had cleared his initial fright. “Get on back! I’ll protect you!”

“You’re quite kind. Th-thank you!” Bernadetta’s eyes sparkled when he felt the fur that she climbed atop of, finding herself wanting to cling and not let go. Luigi, meanwhile, knew where this was going, clinging harder while Zenitsu found himself having to get out of the way quick.

Ironically, the moment the imaginary friend charged forth, the doors immediately opened, causing him to comically trip onto the ground with his two riders. Zenitsu sweat-dropped at the sight of this. “I’m doomed.”

 

Team #7: Nighthawk87

 

The Equestrian unicorn known as Jet Hex had been away from Ponyville for some time, but news had traveled fast of the town’s fate. Not that it would be hard to hear of it, given the sheer devastation the planet was going through.

“They’re gone…they’re gone…” He repeated to himself, panting heavily after the ‘Spawn of Ragnarok’ had broken into his home at the moment of his teleportation. Indeed, those horrific creatures had begun to spread, bringing chaos and mayhem in their wake. His spells had been enough to keep them at bay, but they just kept coming.

“First time?” The feminine 20-something dragon, Spike, asked, his tail swaying around as he rested against the side of the Arena box.

“First time what?” Jet turned to the draconic one, recognizing him. “Wait, if you’re here-“

“Doesn’t look like any of my friends are here either. Just know that we’re about to get put through Tartarus if we don’t think fast.” Spike pointed out.

“DO NOT FEAR! THE GREAT AND POWERFUL TRIXIE IS HERE!” The boisterous stage magician unicorn had also made herself known, using a smoke bomb to dramatically make her appearance known.

That just led to the duo having a coughing fit. “ACK! It’s…cough…an honor…cough…to meet you in the flesh!” Jet tried to speak, having been a fan of the illusionist’s shows for some time.

“Ah! Even better! Trixie would have complained about the drab conditions she has suddenly found herself in…in fact, Trixie was this close to freaking out…but to know that she still has fans after all this time warms her talented heart!”

“YOU!” Spike shouted, coughing a bit more as he pointed at the magician. “Aren’t you that same unicorn that teamed up with Mokushiroku?!”

Hearing that caused the magician to sigh. “It’s…a long story. Let’s just say that me and that jerk had some creative differences. Just know that, whatever harm has come to our world, none of it was Trixie’s fault.”

“Wait a sec. Where HAVE you and your buddies been? We haven’t seen you in…ever. Probably for the best.” He almost calmed before narrowing his eyes. “Waaaaait a minute. That sounds suspicious.”

“A little touchy, aren’t we?” Jet wondered before noticing a figure huddled in the corner. “You good?”

Muttering to herself more loudly, the shut-in of a bookworm known as Moondancer was furiously scribbling into her notebook, accounting for everything that had happened before slamming her book shut. “You all want Twilight back, right?” She said quietly.

That caused all three to pause. “Excuse me?” Spike blinked.

“But isn’t she no longer with us?” Trixie wondered.

Standing up, the sweater-wearing nerd gripped her book tighter. “This place…I’ve heard of it in legends. This…’arena’…it could be the means of bringing her back.”

Remembering his own experiences in the Arena, Spike gasped. “Big Mac’s balls, you’re RIGHT! This place! I know how it works! If even one of us wins, we can bring her back and, maybe even better, restore all of Equestria!”

“I vote for the latter option! Equestria can thrive again with the help of the GREAT AND-“

“NO! It’s Twilight we need!” Moondancer insisted, only to backtrack. “Of course, if we can revert everything back to how it once was before Starfleet arrived, that could solve all problems…”

“Changing the past is kind of reckless. If this place really does all that at the end…you know what they say about wishes. You can never be TOO careful.” Jet pointed out.

Any further discussion was going to have to wait, as the doors were opening…and the screaming from outside was getting even more haunting.

 

Team #8: Buddhe

 

Dr. Phineas Waldolf Steel was more used to being the one causing mayhem in his pursuit of world domination. To be caught in the middle of it was…interesting, to say the least.

“This wasn’t in the schedule!” The bearded one said to himself, getting out a slip of paper from his shirt. “8:30 was when I give my robot doll army the power to shoot lasers from their eyes. If I don’t get back home, I’ll miss my favorite show on top of everything else!”

“Um…excuse me…I don’t mean to be a bother, but…where are we?”

Looming over the mad scientist was a large draconic humanoid. Curvaceous, pudgy, and sporting evergreen scales, she looked like she was nervous 24/7, twiddling her claws while struggling to maintain her composure. “I-I-I’m sorry! I didn’t mean to assume you knew the answers-“

“Actually, my gargantuan reptilian friend, you are right to think I have the answers! I have the power of my brilliant mind to help me get through what is obviously a sleep deprivation-induced fever dream of mine!” Steel put his hands on his hips. “Finally! I think I’ve cracked the code to being FULLY in charge of my dreamworld!”

“…what?” Maple blinked, only to feel something brush against her large tail.

Turning to apologize to whoever she accidentally nudge, she saw that it was a demure-looking shark anthro in a Victorian-era maid uniform. Despite being intimidated by the draconic one’s height, she still tried to sign for ‘hello’, as well as asking where the exit was.

She was also noticed by Dr. Steel, his eyebrows raising in surprise. “A land shark? This dream realm is getting more interesting!” He examined her outfit more closely, giving a soft smile. “Takes me back to the time I made ‘Blade Maid Doll 9000’. Could shred through titanium and dust particles in less than a second.”

“Verdammt nochmal. What was in that vodka?”

A very very very VERY unwelcome face was also among this group, holding a rifle and still dressed as he was during his atrocities in the Congo during the 60s. Plucked from a fictional version of history was one of its monsters. A depraved brute who gained a reputation as a horrible butcher who reveled in his own corruption.

Siegfried Muller.

Getting his bearings, the man gave an ugly grin when he saw the strange sight of a walking shark and a reptilian-looking woman. “This is going to look so good on the jeep.” He momentarily forgot his shock at being transported from his timeline, ready to indulge in his cruelty once more.

Dr. Steel was suddenly in front of him, brandishing a gasoline squirt blaster (essentially, a makeshift flamethrower). “Hold on! I know my history! This dream’s turning into a nightmare, but not on my watch!”

“Can we talk about this?! Nothing good comes from violence!” Maple insisted, while the Lonely Shark hid behind her large tail, not looking forward to the fight about to happen.

Before anybody could come to blows, the doors began to open…

 

Team #9: Snivygreen22

 

“SURPRISE!”

“BOO!”

“SCREE!”

“What’s up?”

All four figures had tried to spook each-other on instinct for their own reasons, but what they got instead was a whole lot of confusion.

The first of which was a Karakasa named Kogasa Tatara, who came in the form of a woman with heterochromia, a blue dress, and a one-eyed umbrella with a long tongue. All she wanted to do was surprise people in her cemetery, but she didn’t expect to find herself confronted by three somehow scarier beings!

One of which was a terrifying sapient pumpkin-headed scarecrow that carried a sharp hoe. His origins wrapped in mystery, this otherworldly being was now looking less than pleased to see that he wasn’t in his beloved cornfield and his compatriots were also nowhere to be seen. “What the?!” He exclaimed, looking around in shock. “Where am I?!”

The animal of the group that had screeched in territorial rage was a Nightshade Paolomu, the bat-like being almost expelling sleeping gas in order to knock out the perceived threats it found himself sharing space with. Baring its fangs, it backed away, ready to unleash the gasses from its maw.

The final one was a surprising addition: Spooky herself! However, the usually chill yet maniacal ghost was acting differently than usual. Showing no trace of the development she gained through that dollhouse adventure, she started to glitch out, still bearing that smile of hers while brandishing a holographic and still effective knife.

“Eep! I thought surprising people was fun! But to be surprised myself…this is new!” Kogasa admitted, holding her umbrella close while Zardy stalked around her, his eyebrow raised at the strange surroundings.

“You’re no human…and this isn’t home! Somebody let me out of here before I REALLY get upset!” The scarecrow demanded, only to get nearly struck by the Nightshade Paolumu’s tail. “Watch it, you overgrown bat!”

“SCREE!”

“Can you solve my house-house-house-mansion-help-help-of 1000 rooms-rooms?” Spooky asked, her body glitching more and freaking the others out.

Noticing how the door was opening, Kogasa bounded on one of her legs towards it. “That’s it! I’m getting out of here! This is too much, even for me!”

“Wait for me! Us spooks and spirits shouldn’t have to put up with this!” Zardy exclaimed. “Perhaps we can help each-other? I sense great power from you.” He leaned in, grinning.

“Um…okay! It sure feels nice to feel wanted!” She blissfully said, forgetting her troubles almost instantly.

The Nightshade Paolumu, meanwhile, was now observing the glitching ghost, not sure what it was looking at. Meanwhile, Spooky kept t-posing into the wall, unable to phase through and increasing the sense that something really was up…as if it wasn’t obvious enough already…

 

Team #10: GenericoThrown

 

The ever-friendly MRVN unit, Pathfinder, was still his usually cheery self, even after getting transported to a place that he didn’t recognize. “Hello, giant tank robot! Will you be my friend?”

“ZOW! BAM! Would I ever?!” Returning to the Arena was the boisterous and easily excitable Autobot tank, Warpath. He loomed over the smaller robot, kneeling down as he shook his hand with two digits, shaking around the metallic Apex Legend. “I’ve always wanted to take another crack at this place! You ready to rock, whats-your-name?!”

“I don’t know who this ‘Whats-your-name’ is and I don’t know how to ‘rock’, but I know how to fight and ensure my friends don’t get hurt! So, I’m all for this!” The robot gave a thumbs-up, his chest showing a smiley emoticon.

“Heh! I like you already!”

“Well, hello, darling. Fancy seeing you again.” Another returner, the Assaultron known as Kleo, had also returned, trailing one of her claws against Warpath’s thigh. “I hope you’re ready for more gratuitous mayhem and destruction. It’s the perfect idea of a date, no?”

“Kleo?! WHAM! BOOM! This is awesome! You’re here too!” The Autobot stated, gesturing towards the other robot fighter. “Met the new guy yet? Oh! That reminds me! There’s always a fourth guy! Come on out! Join the party!”

Yet another returner, the Geth collective known as Legion, stepped forth, recognizing the mission parameters that were familiar from last time. “Greetings. Given our observations, we are willing to believe that you three are non-hostile robotic lifeforms. Ones that would hopefully assist in our desire to return home to our companions.”

After that lengthy explanation, Warpath just shrugged. “Sure. I just wanna use this a lot.” He tapped his chest-mounted barrel.

“I want to explore and have fun!” Pathfinder exclaimed.

“I want murder.” Kleo’s sole red optic glowed more. “And maybe some ‘interfacing’ with my stud here.”

“Aw, TANK you! Heh!” Warpath chuckled.

In spite of how eccentric their team was, Legion would not let that negatively influence them as they readied their sniper blaster. If this was going to happen like last time, he would need to be prepared for anything. Hopefully not an army of endless giant robotic insects, but still.

 

Team #11: Malice

 

While only one or two of these combatants had to deal with this Arena, all four were connected by the fact that they had been chosen at some point or another by the enigmatic ‘Entity’ to participate in a twisted game of hide-and-seek in order to provide despair/hope-based nutrients for the mysterious being.

They included the Shape himself. The masked killer better known as Micheal Myers, back in his prime and staring vacantly at the surroundings around him. Was he confused? Treating this like an average Tuesday? Thinking of nothing else except who his next victim would be? Nobody could figure it out, given the mask.

All that could be assured was that absolute evil dwelled behind those eyes. Evil, plain and simple.

Far less evil and much more reluctant to take part in any murderous havoc was Susie Lavole, having been ripped from the collective killer known as ‘the Legion’. Her tale was one of tragedy, having basically been part of the wrong crowd before finding herself roped into murderous criminal activities and, now, here she was, armed with only her custom broken ruler weapon.

No longer feeling the influence of her fellow Legion members, Susie began to panic, gripping her weapon before realizing Michael was staring at her, those cold emotionless pits around the mask that were supposed to be eyes making her back into the other killer of the bunch. “So…you too, hm?”

A hideous amalgamation of rotting animatronic bunny suit and rotting serial killer corpse within, William Afton/Springtrap had returned to the Arena, a fire axe in his hands. “Given your get-up…I’d say you’re here to join in the fun. Shame I consider myself a solo act.”

“What…the fuck?!” Susie backed away, the sight of the two terrors quite a lot for her to bear, though that was nothing compared to the spectral being of rage that was making herself known via a horrifying scream of fury.

Wearing nothing but a sarashi outfit and armed with a broken katana, as well as looking like one of her arms and legs were held together by spectral energies only, this was Rin Yamaoka, better known as ‘the Spirit’. Still seeking brutal justice for her murder, she could only see her father when she saw the other three combatants.

“DIIIIIIIE!” She roared, lunging forth, only to freeze mide-attack. The other three looked confused when that happened, only for it to vanish and, instantly, she was behind Micheal, slashing him across the back.

Already going into attack mode, the knife-wielding killer lunged with his knife, to which she stumbled out of the way. Springtrap was content to watch this fight, watching as the door started to open.

“The real party’s out there. You two play nice. I’ve got a game to play.” He stated, eagerly awaiting not only total victory, but also the chance to spread some more chaos.

Susie, meanwhile, wasn’t sure whether to blush  hard at the sight of the rather beautiful (if still gruesome) spirit…or flee before Rin turned her attention towards her. She already knew her life was going to take a permanent turn towards the weird and frightening after that fog took her and her friends into the Entity’s realm.

Now? They were gone and she was the only one left here. Adjusting her mask, she ran towards the exit, hoping the undead-looking bunny killer wouldn’t notice or care when she crawled under the opening doors to what was going on outside…

 

Team #12: The Wandering Pikachu

 

What a strange and melancholy day to be the now college Kraken known as Ruby Gillman. She and her best friends were about to be accepted to the same place and NOW the Arena had transported her to an entirely new location. “Huh?! Where am I?!”

“Couldn’t tell you, but could you step aside? The role of main character is FINALLY mine! MINE!” A pudgy cartoonish red/purple octopus exclaimed, squirming next to her. “Seriosuly, scram. You’re in my light.”

“Don’t be so rude. We’re all in the same shocking set of circumstances together.” A much more kindly and cheerful voice spoke, the taller figure being an orange octopus anthro in a slightly revealing blacksmith outfit and a warm smile, as well as a large hat. “Looks like whoever sent us here wanted seafood!”

“Uh…not sure why you would joke about that, but…hmm…we’re obviously here because of magic. I can’t think of any other explanation.” Ruby tried to rationalize things to calm herself down. “I think I heard something about needing to escape or-“

“Or maybe you could stay a moment and watch the revival of my artistic career!” A robotic octopus stepped forth, the former Maverick revealing himself to be Launch Octopus. His many tube-like tentacles writhed around, the mechanical one eager to show just what his definition of ‘art’ was.

One that involved lots of explosions and overall destruction.

“That’s a funny looking suit of armor you have! Maybe I could make some improvements…for a small fee?” Always one to look on the bright side of things, even this strange scenario, Hama was already getting out her hammers and chisels with her tentacles.

“WHAT?! Improve upon perfection? Surely, you jest.” The Reploid spoke in his usual haughty tone before realizing something. “Wait…you three are organic…and I can’t put my tentacle on it…but your looks are quite splendid! Not as much as me, but close!”

“Thanks? I guess?” Ruby awkwardly stated.

“Oh, I get it! This is an RPG and you all are my quirky companions! Better not steal the spotlight from me!” Squid Baron pointed a tentacle in an accusatory way at the Ruby first. “YOU might steal it due to being charmingly awkward!” Then to Hama. “YOU may steal it from me because you have a huge rack!” Finally, to Launch Octopus. “AND YOU BECAUSE YOU DARE TO LOOK COOLER THAN ME!”

“It’s not my fault I’m better than you.” The robot chuckled.

“Can we please focus? I think the door’s opening!” The Kraken pointed out before turning to Hama. “Ready to transform if worst comes to worst?”

“Transform?”

“You know….because you’re a Kraken like me?”

That just caused the blacksmith to give a blushing smile. “That’s such a sweet compliment, but I’m just a humble octopus! Try not to stress out so much. Learn to appreciate the scenery!”

Little did she know just how terrifying or morose or both the ‘scenery’ was going to be...

The stage was set. The doors were opening and everybody would find themselves in the N.A.V.I Jetsuit Evaluation Course. Normally, the convicts who found themselves here would find themselves running through an obstacle course of many jumps, glass walls, conveyer belts, and so forth, the jumpsuit helping those trapped navigate.

The catch? They’d be chased by a massive wall of flames, thanks to mischief on the part of the P.AI.nter. But he wouldn’t be the cause of the mayhem that was about to ensue. Granted, the Firewall was activating, but the room’s lights started to flicker, the background now looking like a hellish red hallway.

In front of all the combatants, a single cartoonish white cat would be sitting in front of them, a melancholy expression on its face. “Face your demons and come out stronger…or succumb and never return.” It spoke with an air of wanting to help, but being unable to do anything.

A distorted laugh/cry rang out, the cat vanishing as the halls glowed even more red, the wall behind the District Boxes no longer being one of flames, but now looking like a hideous red portrait of distorted skeletal corpses. The sight would hurt the eyes of all who looked upon it, but even worse was exactly this thing WAS.

A collective hallucination representing the inner turmoil of the combatants that was there in place of the very real Firewall? A living mental projection that sought to bring agony to all who couldn’t run from it?

“Attention, visitors!” The N.A.V.I voice finally rang out, albeit it sounded like screaming was in the background. “Thank you for making it to the evaluation course! For those who need it, grab a jumpsuit at the start of the course. Then, G E T   O U T   W H I L E   Y O U    S T I L L   C A N ! ! ! ! !

3...

...2...

...1...

ESCAPE THIS HORRIBLE PARADOX!

 

PART 2: The Firewall of Incomprehensible Madness

 

(R U N-Pressure)

https://www.youtube.com/watch?v=auKTQfrfJi0

 

Specimen 7 would waste no time, pushing through the halls as water began to leak through the ceiling, dripping down as the walls continued to glow a horrific shade of red, the screaming from the fiery entity coming close filling the entire course.

“That doesn’t look good.” Pathfinder stated, everybody looking behind themselves.

“That’s not good at all!” Maple cried out, crying in terror at the hideous sight rapidly heading for them.

“What in the Father’s name?!” Gabriel extended his wings, picking up the horror-stricken Isaac while the others got behind his wingspan.

“HAUL ASS!” Velora grabbed Lindsay off her feet, everybody dropping everything to not look back and FLEE!

The chase music was blaring all over the place, Spooky’s distorted laugh/crying also joining the horrific noise. The course also seemed to be bending in on itself, causing it to randomly bend angles and change where the doors to the next room would be shown, almost like this Paradox was forcing this location to conform to whatever rules the Mansion had with limited success.

Pathfinder put his grappling hook to great use, sailing over the course entirely, but always making sure the others were following. Warpath may have been freaked out initially, as he wasn’t built for speed, but he found a way around it.

“KAPOW! BOOM! SHOOM!” He used his own barrel to blast at the platforms, essentially driving and propelling himself backwards through the air. “HOLD ON TIGHT, GUYS!”

Kleo and Legion held onto his body, keeping a watch as so many of the other combatants followed around. The Geth would also fire at several platforms ahead, causing them to fall and provide an extra means of the large Autobot landing somewhere.

Several purple laser blasts smashed through some of the runnable walls, almost knocking Adam Taurus off when he ran across them. The Sentinel was on the warpath, trying to blast its foes while sharing none of the fear of being chased by the horrific construct behind them. “DESTROY. SLAUGHTER. ANNIHILATE.”

“Annihilate THIS! KAPOW!” Aiming his shot just right, Warpath fired at one of the robot’s legs, disabling one of his rockets and causing him to stumble long enough to collide into the rapidly approaching wall.

Letting out a horrible mechanical screech, it was reduced to lifeless metal, burning up and exploding while Specimen 7 continued on its path, Gabriel being among those flying to escape the madness.

However, as he flew through the air, holding Isaac and the Knight close, Terry was holding onto his leg, trying not to let go. “I’m slipping!” He cried out.

“Do not lose heart! Hold on for just a little while longer and we’ll…” Letting out a gasp, the angelic figure noticed a familiar face running across the walls and effortlessly platforming through the mayhem. “YOU! MACHINE! I KNEW OUR PATHS WOULD CROSS ONCE MORE!”

Flying down to intercept V1, his two words were parried successfully, the machine flinging several coins that he shot at, resulting in the ricochet striking the angel and nearly making him lag enough for the wall to consume him.

A fate that unfortunately happened to Terry. “GAAAAAAAAUAUAUAUAAUA!” Becoming one with the wall as he burned alive, his screams echoed while Gabriel increased his speed, shamefully looking away as Isaac wept and the Knight got atop his back, taking a more active role in making sure they’d get out alive.

‘How could I let my wrath overtake me in such a pivotal moment?! Damn this machine…damn what it has done to me.’ He thought, only to shatter through a glass wall. “FUCK! MY EYES!” He gasped again when he realized what he said in front of Isaac. “I mean ‘FUDGE’! That’s what I said!’

“Hehehahahahaha!” Ivan Ooze had transformed into a shimmering flying pile of goop with his face, slithering under most of the fighters. “See ya’, drips!”

“Who are you calling ‘drips’?!” Squid Baron shouted, running as fast as his tentacles could carry him while Ruby, transformed into her Kraken form, pushed through most of the course, squeezing through even the smallest holes (comparable to her kaiju-sized form, that is) and keeping Hama and Launch Octopus close.

“Don’t look back, don’t look back, don’t look back…” She kept repeating to herself, almost feeling one of her feet-like tentacles get near the wall and feel the sheer amount of suffering that being even in the vicinity was bringing her mind.

“This is humiliating! I want to fight! How else can I do my art?!” Launch complained, even as his tentacles wrapped around the fingers holding he and Hama close to their giant companion.

The Squid Baron would join them when he got a ki-blast to the side, sending him into the embrace of the rushing Kraken. The culprit was Perfect Cell, the flying being grinning while outpacing most of the other combatants. “Amateurs.” He yawned, but he made the mistake of looking back during then.

Even for a vile being like him, the suffering that was shown within that seemingly living wall caused his inner circuitry to crackle, his wings spasming and screwing up his flight pattern. “WHAT THE HELL?!” He cried out, spiraling through the air while smashing through several platforms and runnable walls.

As he stumbled mid-air towards the exit, Moondancer was among the many outfitted with the Jetsuit, allowing her to keep pace with the others while she and the other members of her team fled. “According to my calculations-“

“LESS CALCULATING AND MORE RUNNING! TRIXIE IS TERRIFIED!” The magician interrupted the unicorn, also using a jumpsuit that she found enhanced by Jet Hex’s magic.

“At least the first part of my name is making even more sense than normal!” He chuckled, his horn working the dark magic into overdrive as the suits unleashed black flames from their boosters, sending them hurtling through the maze and bypassing many of the obstacles.

Spike was also keeping pace, but only because he was flapping his wings as much as he could. “Wait…for me, guys!” He shouted, trying not to look back and REALLY trying to tune out the possible screaming voice of Twilight Sparkle.

Moondancer almost faltered because of that, but another burst of black magic from Jet Hex ensured she would be propelled before she could hesitate long enough for the wall to claim another victim.

Dr. Steel had a way to bypass this terrible situation. An appropriately zany one, at that! Basically, a propeller hat that spun at such a speed that the winds could be comparable to a hurricane. “Hold on ti-OOF!” His hat nearly failed when Maple grabbed onto his leg, the Lonely Shark huddled into her chest during so.

“P-please hurry!” The draconic one begged, scared tears streaming down her face as she heard the screaming get louder. “I don’t want to die! I never got to confess to Herald how I feel!”

“We’re not going to die! NOT WHEN I SHIFT INTO MAXIMUM OVERDRIVE!” He tapped on his hat, causing the propeller to spin even faster, blowing all three combatants forward while they spun around helplessly. They’d be alive at the end, but VERY nauseous as a result.

Oh, and where was Muller during this whole chase? Simple. Dr. Steel tripped him before this could begin and he was the first one consumed by Specimen 7. Simple as that. Serves him right.

Anyway, moving on.

The Drifter and the Beheaded were no strangers to platforming, so they didn’t need the suit while they dashed and sped their way through the seemingly endless halls. “I think we’re losing it!” The latter stated, despite that NOT being the case. It was like the strange Specimen was getting faster and louder…

Something that Velora was keenly aware of when she rushed across the platforms, her training with Talon really paying off. “C’mon…work through the pain! Don’t look ba-ACK! Where did the lights go?!”

Lindsay’s breasts had found themselves covering her vision, the woman holding on tightly to the now blinded Megalodon. She was too busy screaming to hear the shark anthro’s objections, but, thankfully, the electroreceptors the muscular one had allowed her to at least follow the ones running ahead of her, allowing her to still make it through the course.

Big was using his fishing pole to grapple from one place to the other, his surprising speed also helping him during this. “Wait for me, guys!” He declared, meeting Eduardo and company while he swung around. “Hello!”

“HOLA! NOT TALK NOW! GOT TO RUN!” Eduardo was screaming his head off, the others huddling around him doing much of the same.

Unfortunately, their luck would not be so good, as the Nightshade Paolumu flew over them, expelling sleeping gas as it kept refilling the air sacs that contained it, propelling itself faster in an attempt to flee the strange thing chasing it down.

“Need…siesta…” Eduardo started to feel so drowsy that he wound up slowing down on a conveyer belt that was moving backwards. Lazily, he tried to save his friends by throwing them forth…and only succeeded with Luigi.

The drowsy plumber would wake up VERY quickly when he found himself landing on the Spirit, the entity having been driven furiously wild by the pain happening within her already tortured mind. “RAAAAAAAAGH!” She screeched, randomly slashing her katana while Luigi found herself holding onto her back.

He was practically ragdolled through the air during this chase (despite being taller and larger than her), phasing along with her and making him scream louder. His screaming only ceased when he looked back, looking horrified at the fates of his companions.

Eduardo’s howls of agony. Bernadetta’s screams of anguish. Zenitsu’s cry for his friends. All becoming one with the Specimen while their bodies burned up in a horrific display of red light and the fusing of their skeletons with the mass.

Luigi couldn’t get those voices out of his head. He felt tears form in his eyes as he tried to work through his fear. Letting go of the spirit he was riding atop, he narrowly avoided a slash of her katana as he increased his pace, his good jumping abilities coming in clutch for the final stretch of the chase.

The Pure Vessel dashed through the halls, slashing through any obstacles as he occasionally clashed with Meta-Knight. Their blades sent sparks around the hallway, the smaller winged knight flying circles around the insectoid warrior, but the other countered with teleports and random spears coming out of nowhere.

Their clash was nearly interrupted when the Cobragator flew through the air, rode atop by Jagi as he punched down on the poor creature’s head. “HURRY THE FUCK UP, YOU STUPID SHIT!” He tried to sound intimidating, but he was panicking deep down, having made the mistake of looking behind and seeing the horrific thing that was intent on chasing the combatants down.

Two of those acing the obstacle course without the jumpsuit were Juri and Mileena, the two dropping their usual sadism to focus on getting away from whatever this THING was. Not that the mental anguish this thing wrought was making it easier.

It was driving Mileena into an animalistic frenzy, her sais helping her to rush on all fours across the platforms and through the doors, while Juri was screaming in both fury and pain, hating having to go through the traumas she went through before in her own mind while also trying to win this.

Spooky was still glitching as she phased through pretty much everything, while Zardy used the jumpsuit and his hoe to swing and zoom through the landscape, Kogasa flying through the air current made by Dr. Steel with her umbrella. “This isn’t surprising! This is TERRIFYING!”

“It is what it is! KEEP GOING!” Zardy commanded, wishing he had rose atop the Nightshade Paolumu to make this easier.

Finally, Springtrap, Micheal, and Susie had also put on the jumpsuits, with the Shape brute-forcing his way through the platforms in an attempt to stab into anybody that tried to escape him. If anything, the entity behind him was amplifying his murderous impulses.

The near-undead rabbit-like figure was more focused on getting out of there, grasping his head when he almost heard the angered screams of his victims behind him. “Nonononono….NOT AGAIN! I’M NOT LOSING TO YOU AGAIN!” He roared, dashing enough to make his suit start to malfunction.

With the terrified Susie being the last to enter through the exit, the warped nature of this Paradox would ensure that all remaining had escaped the terror of Specimen 7 would find themselves in random corners of this Paradox.

And there was also the sense that someone was watching them. Someone viewing this event with hate…and a tinge of fear. Someone or something that would do anything to see that certain friends of his would continue to prosper from this grim place, damn the consequences...

Notes:

Current Dead:

-Sentinel (Team 5)
-Terry Hintz (Team 4)
-Bernadetta Von Varley, Eduardo, Zenitsu Agatsuma (Team 6)
-Siegfried Muller (Team 8)